Zapalenie przedsionka

Droperidol (2,5 mg do 10 mg) wymieniono jako opcję leczenia w artykule Clinical Practice na temat zapalenia nerwu przedsionkowego przez Baloha (wydanie z 13 marca), z chorobą wątroby lub nerek wymienioną jako środek ostrożności. W grudniu 2001 r. Urząd ds. Żywności i Leków (FDA) wzmocnił ostrzeżenia o stosowaniu droperidolu, w szczególności dodając czarną skrzynkę ostrzeżenie o zgonach związanych z wydłużeniem odstępu QT i torsade de pointes. Zalecono, aby droperidol był zarezerwowany do leczenia pacjentów, których stan nie reagował na inne terapie i był stosowany tylko wtedy, gdy korzyści przewyższały ryzyko; zalecano również rutynowe wykonywanie monitorowania czynności życiowych i elektrokardiografii podczas leczenia. Continue reading „Zapalenie przedsionka”

żółta gorączka szczepionka

Wykazano znaczne niedobór angiografii zarówno wśród pacjentów leczonych produktem Medicare, jak i VA, jednak pacjenci z VA byli znacznie mniej niż pacjenci z Medicare poddawani wymaganej angiografii (43,9 procent w porównaniu z 51,0 procent, względne ryzyko dostosowane do wieku, 0,77, 95 procent przedziału ufności, 0,72 do 0,82) (Tabela 3). Po wydłużeniu okresu badania do 90 dni po przyjęciu indeksu i zastosowaniu obu źródeł danych Medicare i VA w celu oceny wskaźników postępowania w kohorcie VA, wyniki były podobne (Tabela 3), co sugeruje, że absolutorium i ponowne przyjęcie pacjenci z VA nie byli odpowiedzialni za wyniki badań, ani też nie preferowali pacjentów z VA w celu poddania się procedurom w ramach finansowania Medicare. Pacjenci objęci opieką w systemie VA pozostawali rzadziej poddawani rewaskularyzacji, nawet jeśli analiza została dostosowana tak, aby objęła tylko pacjentów, którzy wymagali i faktycznie przeszli angiografię w ciągu 90 dni po przyjęciu indeksu (Tabela 3). Skorygowana Angiografia i wskaźniki śmiertelności
Tabela 4. Tabela 4. Continue reading „żółta gorączka szczepionka”

Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 5

21 sierpnia przestał reagować i wymagał wentylacji mechanicznej. Testy PCR seryjnych próbek surowicy ujawniły przedłużoną wiremię, z kwasem nukleinowym wirusa West Nile obecnym w próbkach uzyskanych 14 sierpnia (pierwsza dostępna próbka po transplantacji) do 25 sierpnia, 23 dni po transplantacji. Próbki płynu mózgowo-rdzeniowego i surowicy otrzymane 24 sierpnia i przetestowane w Departamencie Zdrowia w Laboratoriach Florida Florida były pozytywne dla przeciwciała IgM wirusa West Nile na ELISA wychwytującym przeciwciała IgM. Objawy pacjenta uległy poprawie i został wypisany do domu 25 września. Pacjent 4
Pacjentka 4 była 71-letnią kobietą z przewlekłym zakażeniem wirusem zapalenia wątroby typu C i rakiem wątrobowokomórkowym, który otrzymał wątrobę dawcy. Continue reading „Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 5”

Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 5

W analizie kohortowej średnie różnice najmniejszych kwadratów różnicowały grupę enfuwirtydową we wszystkich punktach czasowych do 24 tygodnia, a różnice były znaczące (P <0,05) w tygodniach 4, 8, 12 i 16. W 24 tygodniu, większy odsetek pacjentów w grupie z enfuwirtydem niż w grupie kontrolnej klasyfikowano jako mających odpowiedź wirusologiczną zgodnie z każdym z trzech kryteriów odpowiedzi (Tabela 2). Podobne różnice między grupami leczonymi obserwowano również w 8 tygodniu i były istotne dla wszystkich kategorii odpowiedzi wirusologicznej, z wyjątkiem poziomu RNA HIV-1 w osoczu poniżej 50 kopii na mililitr.
Grupa enfuwirtydu również miała znacznie krótszy czas odpowiedzi wirusologicznej niż grupa kontrolna, gdy kryterium odpowiedzi było poziom RNA wirusa HIV-1 poniżej 400 kopii na mililitr (P <0,001 w teście log-rank) i gdy kryterium było spadek od poziomu podstawowego w poziomie RNA HIV-1 w osoczu co najmniej 1,0 log10 kopii na mililitr (P <0,001 w teście log-rank). Mediana czasu do odpowiedzi wirusologicznej zdefiniowanej jako poziom RNA wirusa HIV-1 poniżej 400 kopii na mililitr została oszacowana na 113 dni w grupie enfuwirtydu i nie można jej było oszacować w grupie kontrolnej. Continue reading „Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 5”

Krótka terapia: Mity, metody i metafory

Ta książka jest zbiorem artykułów i prezentacji na temat hipnozy i psychoterapii, opublikowanych w podziękowaniu Miltona Ericksona za krótką, skoncentrowaną terapię. Zawiera wiele szczegółowych informacji na temat teorii i praktyki krótkich form psychoterapii. Książka jest podzielona na dziewięć sekcji, w tym przegląd i dyskusje na temat terapii rodzinnej, czynniki czasowe w krótkiej terapii, techniki, modele i wyróżniające cechy krótkiej terapii, szczególnych problemów i uzdrawiania ciała umysłu. Uczestnicy to specjaliści w zakresie zdrowia psychicznego z różnych dziedzin, ze znacznym zakresem zainteresowania.
Brief Terapia jest wyraźnie w tradycji Erickson, przełomowej postaci w badaniu i praktyce hipnozy i psychoterapii. Continue reading „Krótka terapia: Mity, metody i metafory”

Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II ad 5

Zidentyfikowali jeden lub więcej błędów zarządzania odpowiadających 58 procentom wszystkich zdarzeń niepożądanych, ale tylko 28 procent zdarzeń ostatecznie spełniło nasze wymagania dotyczące oceny zaniedbania. Dla każdej klasy błędów procent przypadków, które ostatecznie przypisano zaniedbaniu, przedstawiono w tabeli 6. Najczęściej występująca klasa błędów, stanowiąca 35 procent wszystkich błędów w tej serii, dotyczyła wykonania procedury lub operacji. Błędy w zapobieganiu (tj. Brak środków zapobiegawczych) były następnym najczęstszym procesem), a następnie błędy diagnostyczne (14 procent). Continue reading „Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II ad 5”

Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II

W ostatnich latach niepokój związany z rosnącymi kosztami składek na ubezpieczenie od nadużyć doprowadził do licznych reform w zakresie tortur. Jednocześnie, w dużej mierze niezależnie od reformy tortur, wzrosło zainteresowanie inicjatywami mającymi wpływ na jakość opieki. Co ciekawe, problem urazu medycznego otrzymał stosunkowo niewielką uwagę z obu perspektyw. Ale ważnym celem dla osób zajmujących się zarówno zaniedbaniami lekarskimi, jak i jakością opieki jest zapobieganie jatrogennym obrażeniom. Pierwszym krokiem w zapobieganiu jest lepsze zrozumienie rodzajów takich obrażeń i ich przyczyn. Continue reading „Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II”

Wywołane glukozą zmęczenie wysiłkowe w niedoborze fosfofruktokinaz mięśni ad 6

Uważa się, że komórkowa podstawa do atenuowanej maksymalnej ekstrakcji tlenu i niskiego maksymalnego poboru tlenu w niedoborze fosforylazy mięśniowej jest fosforylacją oksydacyjną ograniczoną przez substrat.23 Proponujemy podobny mechanizm, który uwzględnia defekt w utlenianiu u pacjentów z niedoborem fosfundruktazy mięśniowej. Blok w utlenianiu glikogenu mięśniowego zwiększa zależność pacjentów od krążących substratów utleniających w celu spełnienia wymagań energetycznych podczas ćwiczeń. Jest to zilustrowane przez znaczną zmienność zdolności do dynamicznych ćwiczeń u pacjentów z niedoborem fosforylazy mięśniowej, zgodnie z dostępnością paliw przenoszonych przez krew. Pearson i współpracownicy użyli terminu drugi wiatr , aby scharakteryzować wzrost zdolności do ćwiczeń, który pojawia się spontanicznie lub w odpowiedzi na wlewy węglowodanów lub lipidów u pacjentów z niedoborem fosforylazy mięśniowej6. Wspólny mianownik drugiego wiatru – osiągnięty spontanicznie przez infuzje substratu lub przez interwencje, które zwiększają mobilizację substratu, 7 przepływy krwi w mięśniach, 8 lub transport paliwa komórkowego24 – jest najwyraźniej zwiększoną podażą komórkową utlenialnego substratu, a tym samym zwiększoną szybkość wytwarzania trifosforanu adenozyny przez fosforylację oksydacyjną.9,23 Blood glukoza jest ważnym paliwem utleniającym w niedoborze fosforylazy mięśniowej. Continue reading „Wywołane glukozą zmęczenie wysiłkowe w niedoborze fosfofruktokinaz mięśni ad 6”

Wywołane glukozą zmęczenie wysiłkowe w niedoborze fosfofruktokinaz mięśni czesc 4

Wyniki wyrażono jako średnie . SEM. Statystyczne znaczenie różnic wartości podczas wlewu glukozy, postu i wlewu triglicerydów-heparyny określono za pomocą powtarzanych pomiarów jednokierunkowej analizy wariancji. Zastosowano test wielokrotnych porównań Newmana-Keulsa w celu przetestowania specyficznych różnic międzygrupowych. Wartość AP poniżej 0,05 uważano za wskazującą na istotność statystyczną. Continue reading „Wywołane glukozą zmęczenie wysiłkowe w niedoborze fosfofruktokinaz mięśni czesc 4”

Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4

Dwuniciową matrycę wyizolowano z sześciu niezależnych subklonów pGEM-4Z dla każdego produktu reakcji łańcuchowej polimerazy i każdy zsekwencjonowano w obu orientacjach za pomocą metody 35 kończenia łańcucha dideoksy za pomocą uniwersalnych starterów specyficznych dla .-galaktozydazy. Aby potwierdzić mutację punktową zidentyfikowaną w odwrotnej transkrypcji i amplifikacji transkryptu. -Galaktozydazy A, region genomowego DNA z probanda i od normalnego osobnika, który zawierał ekson 6, powielono za pomocą reakcji łańcuchowej polimerazy, jak opisano powyżej, za pomocą sensowne i antysensowne primery 5 – GGTACCTAATACGACTCACTATAGGGAGAGCTCTGGGTCATCTAGGTAACT-3 i 5 -ACTACTGTCGACCTGATAGTAACATCAAG-3 , odpowiednio. Po ekstrakcji fenolem-chloroformem i wytrącaniu etanolem, zamplifikowane DNA zsekwencjonowano bezpośrednio zgodnie z modyfikacją metody Wong i wsp.36, z końcowym znakowanym oligonukleotydem 5 -ATATGTTAGTGATTGGC-3 ), który zawierał pierwsze 12 zasad eksonu. 6 jako podkład. Continue reading „Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4”