Elektrokardiogram w ostrym zawale mięśnia sercowego

Artykuł przeglądowy Zimetbauma i Josephsona (wydanie z 6 marca) na temat użyteczności elektrokardiogramu w rozpoznawaniu ostrego zawału mięśnia sercowego jest niezbędną lekturą dla każdego, kto dba o pacjentów z podejrzeniem ostrego zawału mięśnia sercowego. Konieczne są niektóre kwalifikacje dotyczące rozpoznania ostrego zawału mięśnia sercowego u pacjentów z lewym blokiem odnogi pęczka Hisa. Chociaż proponowane kryteria2 ułatwiają diagnozę, pojawia się sporadyczny problem, gdy poleganie na kryterium podniesienia odcinka ST o więcej niż 5,0 mm w odprowadzeniach z pierwotnie negatywnymi kompleksami QRS prowadzi do fałszywie dodatniego rozpoznania ostrego zawału mięśnia sercowego. To kryterium jest niespecyficzne w przypadku ostrego zawału mięśnia sercowego, a niektórzy pacjenci, którzy opuścili blok odnogi pęczka Hisa bez ostrego zawału mięśnia sercowego, ale z przerostem lub poszerzeniem lewej komory serca, mają elektrokardiogramy z uniesieniem odcinka ST, które są znacznie większe niż 5,0 mm.3, 4 Zgłoszono związek między dużymi uniesieniami odcinka ST a dużymi zespołami QRS.3 Powtarzająca się elektrokardiografia może również mieć wartość, ponieważ zmiana amplitudy uniesienia odcinka ST sugeruje ostry zawał mięśnia sercowego.5 Wreszcie, ponieważ pomiary Uniesienia odcinka ST są wykorzystywane do rozpoznania ostrego zawału serca u pacjentów z blokiem lewej odnogi pęczka Hisa, rozsądne jest oznaczenie klatki piersiowej w celu zapewnienia powtarzalności seryjnych elektrokardiogramów.5
John E. Madias, MD
Mount Sinai School of Medicine, Nowy Jork, Nowy Jork 10029
[email protected] org
5 Referencje1. Continue reading „Elektrokardiogram w ostrym zawale mięśnia sercowego”

rudna mała szpital ortopedyczny

To, że niedostateczne wykorzystanie procedur wydawało się obejmować rewaskularyzację po wykonaniu angiografii jest jeszcze bardziej niepokojące, chociaż jest to spekulatywne, ponieważ nie byliśmy w stanie ocenić klinicznej potrzeby rewaskularyzacji. Jednakże, gdy kontrolowaliśmy również dostępną na miejscu dostępność zabiegów kardiologicznych, pacjenci z VA byli nie mniej podatni niż pacjenci Medicare na poddanie się klinicznie wymaganej angiografii (iloraz szans, 1,02, przedział ufności 95%, 0,82 do 1,26). To odkrycie sugeruje, że kluczowym czynnikiem niedostatecznej angiografii w systemie VA jest dostępność procedur kardiologicznych na miejscu.
Brak dostępności usług inwazyjnych w każdym szpitalu VA jest częściowo produktem ubocznym regionalizacji. VA wykonuje inwazyjne zabiegi kardiologiczne w kilku ośrodkach w każdej z 22 sieci. Continue reading „rudna mała szpital ortopedyczny”

Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 6

Najczęstszymi oznaki i objawy reakcji w miejscu wstrzyknięcia były stwardnienie, które obserwowano u 318 pacjentów (94,4%); rumień, obserwowany u 306 pacjentów (90,8 procent); oraz guzki i torbiele, obserwowane u 237 pacjentów (70,3 procent). Tylko 11 pacjentów (3,3 procent) w grupie enfuwirtydu i 3 pacjentów w grupie kontrolnej, którzy zmienili leczenie na enfuwirtyd (2,6 procent), zaprzestali leczenia enfuwirtydem z powodu reakcji w miejscu wstrzyknięcia. Zdarzenia niepożądane
Tabela 3. Tabela 3. Częste zdarzenia niepożądane związane z częstym leczeniem w 24. Continue reading „Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 6”

Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 6

31 lipca ostatnia transfuzja podana do dawcy narządów pochodziła od dawcy krwi z wiremią. Żadna inna osoba nie otrzymała żadnych składników od tego dawcy krwi. Dyskusja
Nasze badanie demonstruje transmisję wirusa Zachodniego Nilu poprzez przeszczepione narządy i przetaczaną krew. Wszyscy czterej pacjenci otrzymali narządy od dawcy narządów z wiremią i zachorowali w tygodniach po transplantacji w wyniku infekcji wirusa Zachodniego Nilu. Dawca narządów otrzymał krew od dawcy krwi z wiremią. Continue reading „Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 6”

Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II cd

Prawie połowa zdarzeń niepożądanych (48 procent) wynikała z operacji. Infekcje ran były najczęstszymi operacyjnymi zdarzeniami niepożądanymi, stanowiącymi 29 procent powikłań chirurgicznych i prawie jedną siódmą wszystkich zdarzeń niepożądanych zidentyfikowanych w badaniu. Tabela 2. Tabela 2. Zdarzenia niepożądane związane z narkotykami, w zależności od klasy leku. Continue reading „Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II cd”

Częstość występowania zdarzeń niepożądanych i zaniedbań u hospitalizowanych pacjentów – wyniki badań lekarskich na Harvardzie ad 8

Lekarze nie mogli i nie zostali poproszeni o oszacowanie liczby dni życia straconych w wyniku niekorzystnego zdarzenia. Jest to bardzo ważna kwestia, szczególnie w przypadku śmiertelnie chorego. Na przykład uraz opłucnej utrzymujący się podczas wkładania cewnika do żyły głównej może być bezpośrednią przyczyną zgonu u pacjenta w stanie śpiączki z przerzutowym rakiem płuca, który był poddawany mechanicznej wentylacji z powodu niewydolności oddechowej. Chociaż ten pacjent mógł żyć zaledwie kilka godzin lub dni, w którym nie wystąpiło niepożądane zdarzenie, uznano, że śmierć była wynikiem urazu medycznego. Ponadto, niektórzy pacjenci mogą wymagać opieki i otrzymali ograniczoną opiekę, mimo że fakt ten nie został udokumentowany w dokumentacji medycznej. Continue reading „Częstość występowania zdarzeń niepożądanych i zaniedbań u hospitalizowanych pacjentów – wyniki badań lekarskich na Harvardzie ad 8”

Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym ad 5

W porównaniu z oczyszczonym prawidłowym enzymem, resztkowy enzym w probandzie był wyraźnie mniej stabilny po inkubacji wstępnej w 40 ° C przy optymalnym pH dla enzymu, 4,6 połowa, 37 vs. 12 minut) lub przy pH 7,4. (połowa czasu, 52 vs. 10 minut). Ponadto oczyszczona aktywność resztkowa miała nieco wyższą pozorną wartość Km (stała Michaelisa) niż oczyszczony normalny enzym (3,8 vs. Continue reading „Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym ad 5”

Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4

Dwuniciową matrycę wyizolowano z sześciu niezależnych subklonów pGEM-4Z dla każdego produktu reakcji łańcuchowej polimerazy i każdy zsekwencjonowano w obu orientacjach za pomocą metody 35 kończenia łańcucha dideoksy za pomocą uniwersalnych starterów specyficznych dla .-galaktozydazy. Aby potwierdzić mutację punktową zidentyfikowaną w odwrotnej transkrypcji i amplifikacji transkryptu. -Galaktozydazy A, region genomowego DNA z probanda i od normalnego osobnika, który zawierał ekson 6, powielono za pomocą reakcji łańcuchowej polimerazy, jak opisano powyżej, za pomocą sensowne i antysensowne primery 5 – GGTACCTAATACGACTCACTATAGGGAGAGCTCTGGGTCATCTAGGTAACT-3 i 5 -ACTACTGTCGACCTGATAGTAACATCAAG-3 , odpowiednio. Po ekstrakcji fenolem-chloroformem i wytrącaniu etanolem, zamplifikowane DNA zsekwencjonowano bezpośrednio zgodnie z modyfikacją metody Wong i wsp.36, z końcowym znakowanym oligonukleotydem 5 -ATATGTTAGTGATTGGC-3 ), który zawierał pierwsze 12 zasad eksonu. 6 jako podkład. Continue reading „Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4”

Stopień sedymentacji erytrocytów w zastoinowej niewydolności serca ad 7

Szybkość odzwierciedla dynamiczne zmiany ciśnienia napełniania prawej komory, co jest ważnym wyznacznikiem zdolności funkcjonalnej i odległego wyniku klinicznego u pacjentów z dysfunkcją lewej komory.31-33 W porównaniu z oceną przyłóżkową szyjnego ciśnienia żylnego, pomiar Szybkość sedymentacji może być bardziej precyzyjna i może być rzetelniej stosowana do oceny zmian średniego prawego ciśnienia przedsionkowego, szczególnie gdy centralne ciśnienie żylne jest bardzo niskie lub bardzo wysokie. Niestety, na test łatwo wpływa wiele stanów klinicznych (takich jak zakażenie), które często występują u pacjentów z niewydolnością serca; ten brak siły dyskryminacyjnej znacznie ogranicza wartość testu w rutynowym postępowaniu z tym zaburzeniem. Finansowanie i ujawnianie informacji
Obsługiwane przez granty (R01-HL-25055, K04-HL-01229, T32-HL-07347 i M01-RR-00071) z National Institutes of Health. Dr Packer jest laureatem nagrody Research Career Development Award przyznawanej przez National Heart, Lung and Blood Institute.
Jesteśmy wdzięczni pannie Normie Medina i pani Madeline Yushak za wykonanie pomiarów hemodynamicznych i opiekę nad pacjentami w tym badaniu oraz Pani Jonine Bernstein za ekspercką analizę statystyczną. Continue reading „Stopień sedymentacji erytrocytów w zastoinowej niewydolności serca ad 7”