Zapalenie przedsionka

Droperidol (2,5 mg do 10 mg) wymieniono jako opcję leczenia w artykule Clinical Practice na temat zapalenia nerwu przedsionkowego przez Baloha (wydanie z 13 marca), z chorobą wątroby lub nerek wymienioną jako środek ostrożności. W grudniu 2001 r. Urząd ds. Żywności i Leków (FDA) wzmocnił ostrzeżenia o stosowaniu droperidolu, w szczególności dodając czarną skrzynkę ostrzeżenie o zgonach związanych z wydłużeniem odstępu QT i torsade de pointes. Zalecono, aby droperidol był zarezerwowany do leczenia pacjentów, których stan nie reagował na inne terapie i był stosowany tylko wtedy, gdy korzyści przewyższały ryzyko; zalecano również rutynowe wykonywanie monitorowania czynności życiowych i elektrokardiografii podczas leczenia. Continue reading „Zapalenie przedsionka”

żółta gorączka szczepionka

Wykazano znaczne niedobór angiografii zarówno wśród pacjentów leczonych produktem Medicare, jak i VA, jednak pacjenci z VA byli znacznie mniej niż pacjenci z Medicare poddawani wymaganej angiografii (43,9 procent w porównaniu z 51,0 procent, względne ryzyko dostosowane do wieku, 0,77, 95 procent przedziału ufności, 0,72 do 0,82) (Tabela 3). Po wydłużeniu okresu badania do 90 dni po przyjęciu indeksu i zastosowaniu obu źródeł danych Medicare i VA w celu oceny wskaźników postępowania w kohorcie VA, wyniki były podobne (Tabela 3), co sugeruje, że absolutorium i ponowne przyjęcie pacjenci z VA nie byli odpowiedzialni za wyniki badań, ani też nie preferowali pacjentów z VA w celu poddania się procedurom w ramach finansowania Medicare. Pacjenci objęci opieką w systemie VA pozostawali rzadziej poddawani rewaskularyzacji, nawet jeśli analiza została dostosowana tak, aby objęła tylko pacjentów, którzy wymagali i faktycznie przeszli angiografię w ciągu 90 dni po przyjęciu indeksu (Tabela 3). Skorygowana Angiografia i wskaźniki śmiertelności
Tabela 4. Tabela 4. Continue reading „żółta gorączka szczepionka”

Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 5

21 sierpnia przestał reagować i wymagał wentylacji mechanicznej. Testy PCR seryjnych próbek surowicy ujawniły przedłużoną wiremię, z kwasem nukleinowym wirusa West Nile obecnym w próbkach uzyskanych 14 sierpnia (pierwsza dostępna próbka po transplantacji) do 25 sierpnia, 23 dni po transplantacji. Próbki płynu mózgowo-rdzeniowego i surowicy otrzymane 24 sierpnia i przetestowane w Departamencie Zdrowia w Laboratoriach Florida Florida były pozytywne dla przeciwciała IgM wirusa West Nile na ELISA wychwytującym przeciwciała IgM. Objawy pacjenta uległy poprawie i został wypisany do domu 25 września. Pacjent 4
Pacjentka 4 była 71-letnią kobietą z przewlekłym zakażeniem wirusem zapalenia wątroby typu C i rakiem wątrobowokomórkowym, który otrzymał wątrobę dawcy. Continue reading „Przeniesienie wirusa Zachodniego Nilu od dawcy narządowego do czterech biorców przeszczepów ad 5”

Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 5

W analizie kohortowej średnie różnice najmniejszych kwadratów różnicowały grupę enfuwirtydową we wszystkich punktach czasowych do 24 tygodnia, a różnice były znaczące (P <0,05) w tygodniach 4, 8, 12 i 16. W 24 tygodniu, większy odsetek pacjentów w grupie z enfuwirtydem niż w grupie kontrolnej klasyfikowano jako mających odpowiedź wirusologiczną zgodnie z każdym z trzech kryteriów odpowiedzi (Tabela 2). Podobne różnice między grupami leczonymi obserwowano również w 8 tygodniu i były istotne dla wszystkich kategorii odpowiedzi wirusologicznej, z wyjątkiem poziomu RNA HIV-1 w osoczu poniżej 50 kopii na mililitr.
Grupa enfuwirtydu również miała znacznie krótszy czas odpowiedzi wirusologicznej niż grupa kontrolna, gdy kryterium odpowiedzi było poziom RNA wirusa HIV-1 poniżej 400 kopii na mililitr (P <0,001 w teście log-rank) i gdy kryterium było spadek od poziomu podstawowego w poziomie RNA HIV-1 w osoczu co najmniej 1,0 log10 kopii na mililitr (P <0,001 w teście log-rank). Mediana czasu do odpowiedzi wirusologicznej zdefiniowanej jako poziom RNA wirusa HIV-1 poniżej 400 kopii na mililitr została oszacowana na 113 dni w grupie enfuwirtydu i nie można jej było oszacować w grupie kontrolnej. Continue reading „Skuteczność enfuwirtydu u pacjentów zakażonych lekoopornym HIV-1 w Europie i Australii ad 5”

Migrena: spektrum pomysłów Ból głowy i ból twarzy: Diagnoza i postępowanie

Każda z tych książek wypełnia wyspecjalizowaną niszę; ich nisze są jednak dość wyraźne. Pierwszy, opracowany przez Sandlera i Collinsa, opiera się na prywatnym sympozjum. Każdy rozdział odzwierciedla prezentację i niektóre z dyskusji, które nastąpiły później. Każdy autor jest wybitnym badaczem bólu głowy i każdy przedstawia swoje ulubione spekulacje na temat migreny. Chociaż wiele z tego zostało powiedziane wcześniej, autorzy tutaj są w stanie spekulować z większą swobodą niż zwykle. Continue reading „Migrena: spektrum pomysłów Ból głowy i ból twarzy: Diagnoza i postępowanie”

Epilepsies: Diagnoza i zarządzanie

To dobra książka, książka z punktem widzenia i wyraźnym głosem. Ułożenie dostępnych informacji na temat padaczki jest samo w sobie dużym zadaniem, ale dodanie do niej pewnego stopnia zrozumienia jest niezwykłe. Książki medyczne na duże tematy, takie jak epilepsja, są często kompilacjami esejów obładowanych faktami, ale bez syntezy jednego głosu. Głos za tą książką przedstawia fakty i uczy ich znaczenia. Głos czasami robi się przenikliwy, gdy robi punkt lub poprawia błędne przekonanie. Continue reading „Epilepsies: Diagnoza i zarządzanie”

Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II ad 10

W przypadku zdarzeń niepożądanych, które obecnie nie są możliwe do uniknięcia, postęp będzie pochodził z postępu naukowego, takiego jak opracowanie mniej niebezpiecznych środków chemioterapeutycznych. W przypadku zdarzeń spowodowanych błędem, kontrola będzie wymagać postępu naukowego w niektórych przypadkach, ale uważamy, że postęp będzie również w dużej mierze zależał od analizy systemów, edukacji oraz rozwoju i rozpowszechniania wytycznych i norm dla praktyki. Automatyczne systemy odporne na awarie – takie jak skomputeryzowany system, który uniemożliwia zamówienie lub wydawanie leku pacjentowi o znanej wrażliwości – prawdopodobnie będą odgrywać coraz większą rolę. Zmniejszenie liczby zdarzeń niepożądanych związanych z zaniedbaniem będzie również wymagać większego nacisku na edukację. W zakresie, w jakim niespełnienie standardów praktyki wynika z niewiedzy, skuteczniejsze może być lepsze upowszechnianie i egzekwowanie wytycznych postępowania. Continue reading „Charakter zdarzeń niepożądanych u hospitalizowanych pacjentów – wyniki badań lekarskich w Harvard II ad 10”

Częstość występowania zdarzeń niepożądanych i zaniedbań u hospitalizowanych pacjentów – wyniki badań lekarskich na Harvardzie ad 6

Identyfikacja czynników ryzyka dla zdarzeń niepożądanych, czy to niedbałych, czy nie, stanowi kluczowy pierwszy krok w kierunku ich zapobiegania, ważny cel zapewnienia jakości. W tym badaniu skupiliśmy się na wieku i płci pacjentów oraz na grupach kliniczno-specjalistycznych. Aby zwiększyć precyzję naszych analiz czynników ryzyka, ustandaryzowaliśmy dane zgodnie z naszymi szacunkami ryzyka związanego z poszczególnymi DRG, które doprowadziły do wystąpienia niepożądanego zdarzenia. Stwierdzono, że ta kategoryzacja ryzyka dobrze koreluje z obserwowanymi wskaźnikami zdarzeń niepożądanych, ale nie ze stopniem zaniedbania (załącznik II). Oczekiwano braku wpływu kategorii ryzyka DRG na zaniedbanie, ponieważ wyroki lekarzy dotyczące standardu opieki odzwierciedlały nieodłączną ryzykowność procedury lub stanu chorobowego. Continue reading „Częstość występowania zdarzeń niepożądanych i zaniedbań u hospitalizowanych pacjentów – wyniki badań lekarskich na Harvardzie ad 6”

Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4

Dwuniciową matrycę wyizolowano z sześciu niezależnych subklonów pGEM-4Z dla każdego produktu reakcji łańcuchowej polimerazy i każdy zsekwencjonowano w obu orientacjach za pomocą metody 35 kończenia łańcucha dideoksy za pomocą uniwersalnych starterów specyficznych dla .-galaktozydazy. Aby potwierdzić mutację punktową zidentyfikowaną w odwrotnej transkrypcji i amplifikacji transkryptu. -Galaktozydazy A, region genomowego DNA z probanda i od normalnego osobnika, który zawierał ekson 6, powielono za pomocą reakcji łańcuchowej polimerazy, jak opisano powyżej, za pomocą sensowne i antysensowne primery 5 – GGTACCTAATACGACTCACTATAGGGAGAGCTCTGGGTCATCTAGGTAACT-3 i 5 -ACTACTGTCGACCTGATAGTAACATCAAG-3 , odpowiednio. Po ekstrakcji fenolem-chloroformem i wytrącaniu etanolem, zamplifikowane DNA zsekwencjonowano bezpośrednio zgodnie z modyfikacją metody Wong i wsp.36, z końcowym znakowanym oligonukleotydem 5 -ATATGTTAGTGATTGGC-3 ), który zawierał pierwsze 12 zasad eksonu. 6 jako podkład. Continue reading „Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4”

Stopień sedymentacji erytrocytów w zastoinowej niewydolności serca ad 6

Nie tylko współczynnik sedymentacji korelował odwrotnie z poziomem prawego ciśnienia przedsionkowego przed leczeniem, ale zmiany szybkości korelowały odwrotnie ze zmianami ciśnienia prawego przedsionka podczas leczenia. Ta korelacja wskaźnika sedymentacji z ciśnieniem prawego przedsionka może wyjaśnić, dlaczego zarówno my, jak i Wood2 zauważyliśmy wzrost wskaźnika sedymentacji u pacjentów, którzy mieli diurezę po wdrożeniu skutecznej terapii. Odwrotnie, u pacjentów, u których wystąpiły objawy prawostronnej niewydolności serca i przeciążenia wątroby (co pokazuje zwiększony poziom bilirubiny w surowicy krwi), pomimo optymalnego leczenia digoksyną i lekami moczopędnymi, częstość sedymentacji była obniżona. Warto zauważyć, że związek pomiędzy tempem sedymentacji a średnim ciśnieniem w prawym przedsionku zaobserwował Parry 30 lat temu, 6 ale został uznany przez autora za przypadkowe skojarzenie. W jaki sposób podniesienie średniego ciśnienia prawego przedsionka może doprowadzić do zmniejszenia wskaźnika sedymentacji. Continue reading „Stopień sedymentacji erytrocytów w zastoinowej niewydolności serca ad 6”