Nietypowy wariant choroby Fabryego z objawami zamkniętymi w mięśniu sercowym czesc 4

Dwuniciową matrycę wyizolowano z sześciu niezależnych subklonów pGEM-4Z dla każdego produktu reakcji łańcuchowej polimerazy i każdy zsekwencjonowano w obu orientacjach za pomocą metody 35 kończenia łańcucha dideoksy za pomocą uniwersalnych starterów specyficznych dla .-galaktozydazy. Aby potwierdzić mutację punktową zidentyfikowaną w odwrotnej transkrypcji i amplifikacji transkryptu. -Galaktozydazy A, region genomowego DNA z probanda i od normalnego osobnika, który zawierał ekson 6, powielono za pomocą reakcji łańcuchowej polimerazy, jak opisano powyżej, za pomocą sensowne i antysensowne primery 5 – GGTACCTAATACGACTCACTATAGGGAGAGCTCTGGGTCATCTAGGTAACT-3 i 5 -ACTACTGTCGACCTGATAGTAACATCAAG-3 , odpowiednio. Po ekstrakcji fenolem-chloroformem i wytrącaniu etanolem, zamplifikowane DNA zsekwencjonowano bezpośrednio zgodnie z modyfikacją metody Wong i wsp.36, z końcowym znakowanym oligonukleotydem 5 -ATATGTTAGTGATTGGC-3 ), który zawierał pierwsze 12 zasad eksonu. 6 jako podkład. Struktura wtórna normalnych i zmutowanych enzymów została przewidziana metodą Chou i Fasman37 przy użyciu oprogramowania z University of Wisconsin Genetics Computer Group.38
Wyniki
Badania morfologiczne
Rycina 1. Rycina 1. Fotomikrografy elektronowe próbki endomiokardialno-biopsyjnej z Probandu z chorobą Fabry ego. Panel A pokazuje komórkę mięśnia sercowego wypełnioną pojedynczymi wakuolami związanymi z błoną (tj. Lizosomy) zawierającymi koncentryczne skupienia płytkowe o skupieniu elektronów (x 2300). Panel B pokazuje kapilarę mięśnia sercowego, bez inkluzji lizosomalnych w komórce śródbłonka × 10 000). Badanie światłem mikroskopowym diagnostycznej próbki z biopsji endomiokardialnej ujawniło, że około połowa miocytów zawierała centralnie przechowywany spieniony materiał, który zabarwił metachromatycznie. Ultrastrukturalnie obserwowano typowe koncentryczne inkluzje płytkowate w lizosomach w lizosomach (ryc. 1A), co jest zgodne z rozpoznaniem choroby Fabry ego. Najwyraźniej komórki śródbłonka naczyń włosowatych mięśnia sercowego nie były zaangażowane (ryc. B). Druga próbka z biopsji endomiokardialnej, uzyskana pięć miesięcy później, wykazała identyczne wyniki, oceniane niezależnie przez dwóch patologów. Nie znaleziono dowodów na przechowywanie materiału w badaniu histologicznym lub ultrastrukturalnym próbek mięśni szkieletowych, wątroby, odbytnicy i skóry, w tym małych naczyń krwionośnych i nerwów.
Badania biochemiczne i molekularne
Tabela 1. Tabela 1. Poziomy aktywności .-galaktozydazy A i stężenia globotriazyloceramidu w organizmach członków rodziny Proband i innych grup. Patologiczną diagnozę choroby Fabry ego potwierdzono przez wykazanie zmniejszonej aktywności .-galaktozydazy A w różnych komórkach i źródłach pochodzących od probandu (Tabela 1). Resztkowa aktywność enzymatyczna była obecna w zakresie od około do 25 procent odpowiednich średnich wartości w normalnych źródłach. Warto zauważyć, że aktywność resztkowa była najwyższa w osoczu i hodowanych limfoblastach (odpowiednio 12 procent i 25 procent średnich wartości prawidłowych). Aktywność .-galaktozydazy A w hodowlanych limfoblastach z probandu i od zdrowych osobników została częściowo oczyszczona (około 25-krotnie) za pomocą chromatografii powinowactwa dla termostabilności i badań kinetyki
[podobne: zatoxin pulmo, moringa kapsułki, deslodyna ]